# -*- coding: utf-8 -*-
# Copyright (c) 2016-2017, Zhijiang Yao, Jie Dong and Dongsheng Cao
# All rights reserved.
# This file is part of the PyBioMed.
# The contents are covered by the terms of the BSD license
# which is included in the file license.txt, found at the root
# of the PyBioMed source tree.
"""
##############################################################################
A class used for computing different types of DNA descriptors!
You can freely use and distribute it. If you have any problem,
you could contact with us timely.
Authors: Zhijiang Yao and Dongsheng Cao.
Date: 2016.06.14
Email: gadsby@163.com and oriental-cds@163.com
##############################################################################
"""
from PyDNAutil import GetData
from PyDNApsenacutil import ExtendPhycheIndex
[docs]def CheckPsenac(lamada, w, k):
"""Check the validation of parameter lamada, w and k.
"""
try:
if not isinstance(lamada, int) or lamada <= 0:
raise ValueError("Error, parameter lamada must be an int type and larger than and equal to 0.")
elif w > 1 or w < 0:
raise ValueError("Error, parameter w must be ranged from 0 to 1.")
elif not isinstance(k, int) or k <= 0:
raise ValueError("Error, parameter k must be an int type and larger than 0.")
except ValueError:
raise
[docs]def GetSequenceListAndPhycheValuePsednc(input_data, extra_phyche_index=None):
"""For PseDNC, PseKNC, make sequence_list and phyche_value.
:param input_data: file type or handle.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if extra_phyche_index is None:
extra_phyche_index = {}
original_phyche_value = {'AA': [0.06, 0.5, 0.27, 1.59, 0.11, -0.11],
'AC': [1.50, 0.50, 0.80, 0.13, 1.29, 1.04],
'AG': [0.78, 0.36, 0.09, 0.68, -0.24, -0.62],
'AT': [1.07, 0.22, 0.62, -1.02, 2.51, 1.17],
'CA': [-1.38, -1.36, -0.27, -0.86, -0.62, -1.25],
'CC': [0.06, 1.08, 0.09, 0.56, -0.82, 0.24],
'CG': [-1.66, -1.22, -0.44, -0.82, -0.29, -1.39],
'CT': [0.78, 0.36, 0.09, 0.68, -0.24, -0.62],
'GA': [-0.08, 0.5, 0.27, 0.13, -0.39, 0.71],
'GC': [-0.08, 0.22, 1.33, -0.35, 0.65, 1.59],
'GG': [0.06, 1.08, 0.09, 0.56, -0.82, 0.24],
'GT': [1.50, 0.50, 0.80, 0.13, 1.29, 1.04],
'TA': [-1.23, -2.37, -0.44, -2.24, -1.51, -1.39],
'TC': [-0.08, 0.5, 0.27, 0.13, -0.39, 0.71],
'TG': [-1.38, -1.36, -0.27, -0.86, -0.62, -1.25],
'TT': [0.06, 0.5, 0.27, 1.59, 0.11, -0.11]}
sequence_list = GetData(input_data)
phyche_value = ExtendPhycheIndex(original_phyche_value, extra_phyche_index)
return sequence_list, phyche_value
[docs]def GetSequenceListAndPhycheValuePseknc(input_data, extra_phyche_index=None):
"""For PseDNC, PseKNC, make sequence_list and phyche_value.
:param input_data: file type or handle.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if extra_phyche_index is None:
extra_phyche_index = {}
original_phyche_value = {
'AA': [0.06, 0.5, 0.09, 1.59, 0.11, -0.11],
'AC': [1.5, 0.5, 1.19, 0.13, 1.29, 1.04],
'GT': [1.5, 0.5, 1.19, 0.13, 1.29, 1.04],
'AG': [0.78, 0.36, -0.28, 0.68, -0.24, -0.62],
'CC': [0.06, 1.08, -0.28, 0.56, -0.82, 0.24],
'CA': [-1.38, -1.36, -1.01, -0.86, -0.62, -1.25],
'CG': [-1.66, -1.22, -1.38, -0.82, -0.29, -1.39],
'TT': [0.06, 0.5, 0.09, 1.59, 0.11, -0.11],
'GG': [0.06, 1.08, -0.28, 0.56, -0.82, 0.24],
'GC': [-0.08, 0.22, 2.3, -0.35, 0.65, 1.59],
'AT': [1.07, 0.22, 0.83, -1.02, 2.51, 1.17],
'GA': [-0.08, 0.5, 0.09, 0.13, -0.39, 0.71],
'TG': [-1.38, -1.36, -1.01, -0.86, -0.62, -1.25],
'TA': [-1.23, -2.37, -1.38, -2.24, -1.51, -1.39],
'TC': [-0.08, 0.5, 0.09, 0.13, -0.39, 0.71],
'CT': [0.78, 0.36, -0.28, 0.68, -0.24, -0.62]}
sequence_list = GetData(input_data)
phyche_value = ExtendPhycheIndex(original_phyche_value, extra_phyche_index)
return sequence_list, phyche_value
[docs]def GetSequenceListAndPhycheValue(input_data, k, phyche_index, extra_phyche_index, all_property):
"""For PseKNC-general make sequence_list and phyche_value.
:param input_data: file type or handle.
:param k: int, the value of k-tuple.
:param k: physicochemical properties list.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
:param all_property: bool, choose all physicochemical properties or not.
"""
if phyche_index is None:
phyche_index = []
if extra_phyche_index is None:
extra_phyche_index = {}
diphyche_list = ['Base stacking', 'Protein induced deformability', 'B-DNA twist', 'Dinucleotide GC Content',
'A-philicity', 'Propeller twist', 'Duplex stability:(freeenergy)',
'Duplex tability(disruptenergy)', 'DNA denaturation', 'Bending stiffness', 'Protein DNA twist',
'Stabilising energy of Z-DNA', 'Aida_BA_transition', 'Breslauer_dG', 'Breslauer_dH',
'Breslauer_dS', 'Electron_interaction', 'Hartman_trans_free_energy', 'Helix-Coil_transition',
'Ivanov_BA_transition', 'Lisser_BZ_transition', 'Polar_interaction', 'SantaLucia_dG',
'SantaLucia_dH', 'SantaLucia_dS', 'Sarai_flexibility', 'Stability', 'Stacking_energy',
'Sugimoto_dG', 'Sugimoto_dH', 'Sugimoto_dS', 'Watson-Crick_interaction', 'Twist', 'Tilt', 'Roll',
'Shift', 'Slide', 'Rise']
triphyche_list = ['Dnase I', 'Bendability (DNAse)', 'Bendability (consensus)', 'Trinucleotide GC Content',
'Nucleosome positioning', 'Consensus_roll', 'Consensus-Rigid', 'Dnase I-Rigid', 'MW-Daltons',
'MW-kg', 'Nucleosome', 'Nucleosome-Rigid']
# Set and check physicochemical properties.
phyche_list = []
if k == 2:
phyche_list = diphyche_list
elif k == 3:
phyche_list = triphyche_list
try:
if all_property is True:
phyche_index = phyche_list
else:
for e in phyche_index:
if e not in phyche_list:
error_info = 'Sorry, the physicochemical properties ' + e + ' is not exit.'
raise NameError(error_info)
except NameError:
raise
# Generate phyche_value and sequence_list.
from PyDNApsenacutil import GetPhycheIndex
phyche_value = ExtendPhycheIndex(GetPhycheIndex(k, phyche_index), extra_phyche_index)
sequence_list = GetData(input_data)
return sequence_list, phyche_value
[docs]def GetPseDNC(input_data,**kwargs):
"""Make PseDNC dictionary.
:param input_data: file type or handle.
:param k: k-tuple.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if 'lamada' in kwargs:
lamada = kwargs['lamada']
else:
lamada = 3
if 'w' in kwargs:
w =kwargs['w']
else:
w = 0.05
if 'k' in kwargs:
k = kwargs['k']
else:
k = 2
if 'extra_phyche_index' in kwargs:
kwargs = kwargs['extra_phyche_index']
else:
extra_phyche_index = None
input_data = [input_data]
sequence_list, phyche_value = GetSequenceListAndPhycheValuePsednc(input_data, extra_phyche_index)
from PyDNApsenacutil import MakePsekncVector
vector = MakePsekncVector(sequence_list, lamada, w, k, phyche_value, theta_type=1)
dict_keys = ['PseDNC_%s'%i for i in range(1,len(vector[0])+1)]
res = dict(zip(dict_keys,vector[0]))
return res
[docs]def GetPseKNC(input_data,**kwargs):
"""Make PseKNC dictionary.
:param input_data: file type or handle.
:param k: k-tuple.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if 'lamada' in kwargs:
lamada = kwargs['lamada']
else:
lamada = 1
if 'w' in kwargs:
w =kwargs['w']
else:
w = 0.5
if 'k' in kwargs:
k = kwargs['k']
else:
k = 3
if 'extra_phyche_index' in kwargs:
kwargs = kwargs['extra_phyche_index']
else:
extra_phyche_index = None
input_data = [input_data]
sequence_list, phyche_value = GetSequenceListAndPhycheValuePseknc(input_data, extra_phyche_index)
from PyDNApsenacutil import MakeOldPsekncVector
vector = MakeOldPsekncVector(sequence_list, lamada, w, k, phyche_value, theta_type=1)
dict_keys = ['PseKNC_%s'%i for i in range(1,len(vector[0])+1)]
res = dict(zip(dict_keys,vector[0]))
return res
[docs]def GetPCPseDNC(input_data,**kwargs):
"""Make a PCPseDNC dictionary.
:param input_data: file object or sequence list.
:param phyche_index: physicochemical properties list.
:param all_property: choose all physicochemical properties or not.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if 'lamada' in kwargs:
lamada = kwargs['lamada']
else:
lamada = 1
if 'w' in kwargs:
w =kwargs['w']
else:
w = 0.05
if 'k' in kwargs:
k = kwargs['k']
else:
k = 2
if 'phyche_index' in kwargs:
phyche_index = kwargs['phyche_index']
else:
phyche_index = None
if 'all_property' in kwargs:
all_property = kwargs['all_property']
else:
all_property = False
if 'extra_phyche_index' in kwargs:
extra_phyche_index = kwargs['extra_phyche_index']
else:
extra_phyche_index = None
# Make vector.
input_data = [input_data]
sequence_list, phyche_value = GetSequenceListAndPhycheValue(input_data, k, phyche_index,
extra_phyche_index, all_property)
from PyDNApsenacutil import MakePsekncVector
vector = MakePsekncVector(sequence_list, lamada, w, k, phyche_value, theta_type=1)
dict_keys = ['PCPseDNC_%s'%i for i in range(1,len(vector[0])+1)]
res = dict(zip(dict_keys,vector[0]))
return res
[docs]def GetPCPseTNC(input_data, **kwargs):
"""Make a PCPseDNC dictionary.
:param input_data: file object or sequence list.
:param phyche_index: physicochemical properties list.
:param all_property: choose all physicochemical properties or not.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if 'lamada' in kwargs:
lamada = kwargs['lamada']
else:
lamada = 1
if 'w' in kwargs:
w =kwargs['w']
else:
w = 0.05
if 'k' in kwargs:
k = kwargs['k']
else:
k = 3
if 'phyche_index' in kwargs:
phyche_index = kwargs['phyche_index']
else:
phyche_index = None
if 'all_property' in kwargs:
all_property = kwargs['all_property']
else:
all_property = False
if 'extra_phyche_index' in kwargs:
extra_phyche_index = kwargs['extra_phyche_index']
else:
extra_phyche_index = None
input_data = [input_data]
sequence_list, phyche_value = GetSequenceListAndPhycheValue(input_data, k, phyche_index,
extra_phyche_index, all_property)
# Make vector.
from PyDNApsenacutil import MakePsekncVector
vector = MakePsekncVector(sequence_list, lamada, w, k, phyche_value, theta_type=1)
dict_keys = ['PCPseTNC_%s'%i for i in range(1,len(vector[0])+1)]
res = dict(zip(dict_keys,vector[0]))
return res
[docs]def GetSCPseDNC(input_data, **kwargs):
"""Make a SCPseDNC dictionary.
:param input_data: file object or sequence list.
:param phyche_index: physicochemical properties list.
:param all_property: choose all physicochemical properties or not.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if 'lamada' in kwargs:
lamada = kwargs['lamada']
else:
lamada = 1
if 'w' in kwargs:
w =kwargs['w']
else:
w = 0.05
if 'k' in kwargs:
k = kwargs['k']
else:
k = 2
if 'phyche_index' in kwargs:
phyche_index = kwargs['phyche_index']
else:
phyche_index = None
if 'all_property' in kwargs:
all_property = kwargs['all_property']
else:
all_property = False
if 'extra_phyche_index' in kwargs:
extra_phyche_index = kwargs['extra_phyche_index']
else:
extra_phyche_index = None
input_data = [input_data]
sequence_list, phyche_value = GetSequenceListAndPhycheValue(input_data, k, phyche_index,
extra_phyche_index, all_property)
# Make vector.
from PyDNApsenacutil import MakePsekncVector
vector = MakePsekncVector(sequence_list, lamada, w, k, phyche_value, theta_type=2)
dict_keys = ['SCPseDNC_%s'%i for i in range(1,len(vector[0])+1)]
res = dict(zip(dict_keys,vector[0]))
return res
[docs]def GetSCPseTNC(input_data, **kwargs):
"""Make a SCPseTNC dictionary.
:param input_data: file object or sequence list.
:param phyche_index: physicochemical properties list.
:param all_property: choose all physicochemical properties or not.
:param extra_phyche_index: dict, the key is the dinucleotide (string),
the value is its physicochemical property value (list).
It means the user-defined physicochemical indices.
"""
if 'lamada' in kwargs:
lamada = kwargs['lamada']
else:
lamada = 1
if 'w' in kwargs:
w =kwargs['w']
else:
w = 0.05
if 'k' in kwargs:
k = kwargs['k']
else:
k = 3
if 'phyche_index' in kwargs:
phyche_index = kwargs['phyche_index']
else:
phyche_index = None
if 'all_property' in kwargs:
all_property = kwargs['all_property']
else:
all_property = False
if 'extra_phyche_index' in kwargs:
extra_phyche_index = kwargs['extra_phyche_index']
else:
extra_phyche_index = None
input_data = [input_data]
sequence_list, phyche_value = GetSequenceListAndPhycheValue(input_data, k, phyche_index,
extra_phyche_index, all_property)
# Make vector.
from PyDNApsenacutil import MakePsekncVector
vector = MakePsekncVector(sequence_list, lamada, w, k, phyche_value, theta_type=2)
dict_keys = ['SCPseTNC_%s'%i for i in range(1,len(vector[0])+1)]
res = dict(zip(dict_keys,vector[0]))
return res
if __name__ == '__main__':
psednc = GetPseDNC('ACCCCA',lamada=2, w=0.05)
print(psednc)
PC_psednc = GetPCPseDNC('ACCCCA', phyche_index=["Tilt", 'Twist', 'Rise', 'Roll', 'Shift', 'Slide'],lamada=2, w=0.05)
print(PC_psednc)
pc_psetnc = GetPCPseTNC('ACCCCA', phyche_index=['Dnase I', 'Nucleosome'],lamada=2, w=0.05)
print(pc_psetnc)
sc_psednc = GetSCPseDNC('ACCCCCA', phyche_index=['Twist', 'Tilt'],lamada=2, w=0.05)
print(sc_psednc)
sc_psetnc = GetSCPseTNC('ACCCCCA', phyche_index=['Dnase I', 'Nucleosome'],lamada=1, w=0.05)
print(sc_psetnc)
sc_psetnc = GetSCPseTNC('ACCCCA', phyche_index=["Dnase I", 'Nucleosome'], lamada=2, w=0.05)
print(sc_psetnc)
import time
from PyDNAutil import NormalizeIndex
start_time = time.time()
phyche_index = [[1.019, -0.918, 0.488, 0.567, 0.567, -0.070, -0.579, 0.488, -0.654, -2.455, -0.070, -0.918, 1.603,
-0.654, 0.567, 1.019]]
print('Begin PseDNC')
dic = GetPseDNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC')
print(dic)
print(len(dic))
dic = GetPseKNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC')
print(dic)
print(len(dic))
print('PC-PseDNC')
dic = GetPCPseDNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', phyche_index=['Twist', 'Tilt'])
print(dic)
print(len(dic))
dic = GetPCPseTNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC',lamada=1, w=0.05,k=2,phyche_index=['Twist', 'Tilt'])
print(dic)
print(len(dic))
phyche_index = [
[7.176, 6.272, 4.736, 7.237, 3.810, 4.156, 4.156, 6.033, 3.410, 3.524, 4.445, 6.033, 1.613, 5.087, 2.169, 7.237,
3.581, 3.239, 1.668, 2.169, 6.813, 3.868, 5.440, 4.445, 3.810, 4.678, 5.440, 4.156, 2.673, 3.353, 1.668, 4.736,
4.214, 3.925, 3.353, 5.087, 2.842, 2.448, 4.678, 3.524, 3.581, 2.448, 3.868, 4.156, 3.467, 3.925, 3.239, 6.272,
2.955, 3.467, 2.673, 1.613, 1.447, 3.581, 3.810, 3.410, 1.447, 2.842, 6.813, 3.810, 2.955, 4.214, 3.581, 7.176]
]
from PyDNAutil import NormalizeIndex
dic = GetPCPseTNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', phyche_index=['Dnase I', 'Nucleosome'],
extra_phyche_index=NormalizeIndex(phyche_index, is_convert_dict=True))
print(dic)
print(len(dic))
print('SC-PseDNC')
dic = GetSCPseDNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', phyche_index=['Twist', 'Tilt'])
print(dic)
print(len(dic))
dic = GetSCPseDNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', all_property=True,lamada=2, w=0.05)
print(dic)
print(len(dic))
phyche_index = [[1.019, -0.918, 0.488, 0.567, 0.567, -0.070, -0.579, 0.488, -0.654, -2.455, -0.070, -0.918, 1.603,
-0.654, 0.567, 1.019]]
from PyDNAutil import NormalizeIndex
dic = GetSCPseDNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', phyche_index=['Twist', 'Tilt'],
extra_phyche_index=NormalizeIndex(phyche_index, is_convert_dict=True))
print(dic)
print(len(dic))
print()
print('SC-PseTNC')
dic= GetSCPseTNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', phyche_index=['Dnase I', 'Nucleosome'])
print(dic)
print(len(dic))
dic = GetSCPseTNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', all_property=True,lamada=2, w=0.05)
print(dic)
print(len(dic))
phyche_index = [
[7.176, 6.272, 4.736, 7.237, 3.810, 4.156, 4.156, 6.033, 3.410, 3.524, 4.445, 6.033, 1.613, 5.087, 2.169, 7.237,
3.581, 3.239, 1.668, 2.169, 6.813, 3.868, 5.440, 4.445, 3.810, 4.678, 5.440, 4.156, 2.673, 3.353, 1.668, 4.736,
4.214, 3.925, 3.353, 5.087, 2.842, 2.448, 4.678, 3.524, 3.581, 2.448, 3.868, 4.156, 3.467, 3.925, 3.239, 6.272,
2.955, 3.467, 2.673, 1.613, 1.447, 3.581, 3.810, 3.410, 1.447, 2.842, 6.813, 3.810, 2.955, 4.214, 3.581, 7.176]
]
from PyDNAutil import NormalizeIndex
dic = GetSCPseTNC('GACTGAACTGCACTTTGGTTTCATATTATTTGCTC', phyche_index=['Dnase I', 'Nucleosome'],
extra_phyche_index=NormalizeIndex(phyche_index, is_convert_dict=True))
print(dic)
print(len(dic))
# Normalize PseDNC index Twist, Tilt, Roll, Shift, Slide, Rise.
original_phyche_value = [
[0.026, 0.036, 0.031, 0.033, 0.016, 0.026, 0.014, 0.031, 0.025, 0.025, 0.026, 0.036, 0.017, 0.025, 0.016, 0.026],
[0.038, 0.038, 0.037, 0.036, 0.025, 0.042, 0.026, 0.037, 0.038, 0.036, 0.042, 0.038, 0.018, 0.038, 0.025, 0.038],
[0.020, 0.023, 0.019, 0.022, 0.017, 0.019, 0.016, 0.019, 0.020, 0.026, 0.019, 0.023, 0.016, 0.020, 0.017, 0.020],
[1.69, 1.32, 1.46, 1.03, 1.07, 1.43, 1.08, 1.46, 1.32, 1.20, 1.43, 1.32, 0.72, 1.32, 1.07, 1.69],
[2.26, 3.03, 2.03, 3.83, 1.78, 1.65, 2.00, 2.03, 1.93, 2.61, 1.65, 3.03, 1.20, 1.93, 1.78, 2.26],
[7.65, 8.93, 7.08, 9.07, 6.38, 8.04, 6.23, 7.08, 8.56, 9.53, 8.04, 8.93, 6.23, 8.56, 6.38, 7.65]]
for e in NormalizeIndex(original_phyche_value, is_convert_dict=True).items():
print(e)
